View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6139_low_6 (Length: 323)

Name: NF6139_low_6
Description: NF6139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6139_low_6
NF6139_low_6
[»] chr4 (1 HSPs)
chr4 (271-307)||(52936820-52936856)


Alignment Details
Target: chr4 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 271 - 307
Target Start/End: Original strand, 52936820 - 52936856
Alignment:
271 aatccttgcaaaattgcttataatatatttggtattt 307  Q
    |||||||||||||||||||||||||||||||||||||    
52936820 aatccttgcaaaattgcttataatatatttggtattt 52936856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University