View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6139_low_9 (Length: 251)
Name: NF6139_low_9
Description: NF6139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6139_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 47627299 - 47627537
Alignment:
| Q |
1 |
tgcatgatcacacacaaaatatagagaagatgagtattgcaagttcaaacttgtctcatgcaatatttttatcatcagttgtatttacaggnnnnnnnnn |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
47627299 |
tgcatgatcatacacaaaatatagagaagatgagtattgcaagttcaaacttgtctcatgcgatattattatcatcagttgtatttacaggaaaaaaaa- |
47627397 |
T |
 |
| Q |
101 |
ntgactcaaatgttt-aatttacaatacataaaaaataacagatccaaaaagatctgtaaacagactcgatgtttgttgcttacatttatgaaaatattt |
199 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47627398 |
-tgactcaaatgttttaatttacaatacataaaaaataacagatccaaaaagatctgtaaacagactcgatgtttgttgcttacatttatgaaaatattt |
47627496 |
T |
 |
| Q |
200 |
tttctaagaatttgacattttttaatacactcatccttcat |
240 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
47627497 |
tttctaggaatttgacatttttgaatacactcatccttcat |
47627537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University