View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6140_high_12 (Length: 250)
Name: NF6140_high_12
Description: NF6140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6140_high_12 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 16 - 250
Target Start/End: Original strand, 17501228 - 17501462
Alignment:
| Q |
16 |
aaagtgttgaaatagggtcatctacattaggccatggtgaagaaccagttgccatttcaattatagtgcaaccaagtgaccaaatatcactagaaaactc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17501228 |
aaagtgttgaaatagggtcatctacattaggccatggtgaagaaccagttgccatttcaattatagtgcaaccaagtgaccaaatatcactagaaaactc |
17501327 |
T |
 |
| Q |
116 |
ttgttcttctccacgtgcaacttctggtgccatgaacaccggtgttccgcggattggcgccgcggcttcatttacacttttagcacatccaaagtctcca |
215 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17501328 |
ttgttcttctccacgtgccacttctggtgccatgaacaccggtgttccgcggattggcgccgcggcttcatttacacttttagcacatccaaagtctcca |
17501427 |
T |
 |
| Q |
216 |
attttagccccatcttcaccaatcatgatattggc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
17501428 |
attttagccccatcttcaccaatcatgatattggc |
17501462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 51 - 124
Target Start/End: Complemental strand, 37066478 - 37066405
Alignment:
| Q |
51 |
ggtgaagaaccagttgccatttcaattatagtgcaaccaagtgaccaaatatcactagaaaactcttgttcttc |
124 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||||||| ||||| || ||| |||||||||| |
|
|
| T |
37066478 |
ggtgaaaaaccagttgccatttcaacaatagtgcaaccaagtgaccaaacatcacaagggaacccttgttcttc |
37066405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University