View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6140_low_14 (Length: 249)
Name: NF6140_low_14
Description: NF6140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6140_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 9 - 245
Target Start/End: Original strand, 17501848 - 17502084
Alignment:
| Q |
9 |
aacaaactttatgttattgaatgttgagtttgagttggttattgtagcctttttatacatgtaatattttttggtgttagttaggtgatatttttatacg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17501848 |
aacaaactttatgttattgaatgttgagtttgagttggttattgtagcctttttatacatgtaatattttttggtgttagttaggtgatatttttatacg |
17501947 |
T |
 |
| Q |
109 |
tgtatttgatgagaaattgaatgatggagacaaaattgagtttgatgaggctttgaaggatggttttatgaaaagtgtcctttttattgggttggctact |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17501948 |
tgtatttgatgagaaattgaatgatggagacaaaattgagtttgatgaggctttgaaggatggttttatgaaaagtgtcctttttattgggttggctact |
17502047 |
T |
 |
| Q |
209 |
taatttggttggcgttcactctctatctattcttctc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17502048 |
taatttggttggcgttcactctctatctattcttctc |
17502084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University