View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6140_low_15 (Length: 247)
Name: NF6140_low_15
Description: NF6140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6140_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 122 - 240
Target Start/End: Original strand, 6759618 - 6759736
Alignment:
| Q |
122 |
tacgggtcgtgcatctatcataaattgaagtttgcatttgtgaaagcatgttatactgaggtgaaaattttcggttgggctggatggatgagtaattgac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6759618 |
tacgggtcgtgcatctatcataaattgaagtttgcatttgtgaaagcatggtatactgagttgaaaattttcggttgggctggatggatgagtaattgac |
6759717 |
T |
|
| Q |
222 |
catctctgtacctatgata |
240 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
6759718 |
catctctgtatctatgata |
6759736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 10 - 123
Target Start/End: Original strand, 6759462 - 6759575
Alignment:
| Q |
10 |
acatcatcattgctgcagatatcatagtcgcttaacattgtgacaacaaagtatacatagtgaaaaatttcaatttcggctcaatgtataagtaactaaa |
109 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
6759462 |
acatcatcattgctgcagatttcatagtcgcttaacattgtgacaacaaagtatacatagtgaaaattttcaagttcggctcaatgtataagtaactaaa |
6759561 |
T |
|
| Q |
110 |
catggctggattta |
123 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6759562 |
catggctggattta |
6759575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University