View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6140_low_16 (Length: 223)
Name: NF6140_low_16
Description: NF6140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6140_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 207
Target Start/End: Complemental strand, 798473 - 798284
Alignment:
| Q |
18 |
tcactcaaaactttcagacattatttatatgagtcgtctcacttatatgctgttcaaccacttttccatccaaaatggatttctatcttacatttgacac |
117 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
798473 |
tcactcaaaactttcagacgttatttatatgagtcgtctcacttatatgttgttcaaccacttttccttccaaaatggatttctatcttacatttgacac |
798374 |
T |
 |
| Q |
118 |
acacccgcatggaacaaccaaactttgagtcaatctactcccccacaaaatcttggtattatattttcctatgatataaaccaataaatt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
798373 |
acacccgcatggaacaaccaaactttgagtcaatctactcccccacaaaatcttggtattatattttcctatgatataaaccaataaatt |
798284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University