View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6140_low_8 (Length: 343)
Name: NF6140_low_8
Description: NF6140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6140_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 227 - 324
Target Start/End: Original strand, 5266657 - 5266754
Alignment:
| Q |
227 |
cagtttgatttgtgccactactatggtcttatttgtgtcgcaaaatcagcataaatttgcataaaagtgtgttcattgtcacaaacaagtttggcatc |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
5266657 |
cagtttgatttgtgccactactatggtcttatttgtgtcgcaaaatcagcgtaactttgcataaaagtgtgttcattgtcgcaaacaagttcggcatc |
5266754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 27 - 88
Target Start/End: Complemental strand, 5059339 - 5059278
Alignment:
| Q |
27 |
gtaaaatcatcccttcagaaaagtttgaacattcactttgtaccaatgttttaaaaactgga |
88 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5059339 |
gtaaaatcatcccttaagaaaagtatgaacattcactttgtgccaatgttttaaaaactgga |
5059278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University