View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6141_high_2 (Length: 411)
Name: NF6141_high_2
Description: NF6141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6141_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 143 - 371
Target Start/End: Original strand, 9501505 - 9501733
Alignment:
| Q |
143 |
atattcaaaaggaaaaatattgaataaataagatttaaatgattttgctaacacaaacaagattcttttaagtattacttttgttaattactgcgtcaat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9501505 |
atattcaaaaggaaaaatattgaataaataagatttaaatgattttgctaacacaaacaagattcttttaagtattacttttgttaattactacgtcaat |
9501604 |
T |
 |
| Q |
243 |
gttttgcatacccgtttctttcttaccaaaagaaaaaatgtttaagaaatacagttgaaatgattatgctaacaagacgtatttaggctacataagtatg |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9501605 |
gttttgcatacccgtttctttcttaccaaaagaaaaaatgtttaagaaatacggttgaaatgattatgctaacaagacgtatttaggctacataagtatg |
9501704 |
T |
 |
| Q |
343 |
cataaacaagatttttaagtatagctctc |
371 |
Q |
| |
|
|||||||||||||||||||||| |||||| |
|
|
| T |
9501705 |
cataaacaagatttttaagtattgctctc |
9501733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 17 - 143
Target Start/End: Original strand, 9501350 - 9501480
Alignment:
| Q |
17 |
gttttgagacccttacaatgtataaatatacttttttatccggaatttacgggtactcaaacatggattcagattagc----ttaattgaatgggtagta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9501350 |
gttttgagacccttacaatgtataaatatacttttttatccggaatttacgggtactcaaacatggattcagattagcttaattaattgaatgggtagta |
9501449 |
T |
 |
| Q |
113 |
gactaatttatttacttattttcactcaaaa |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9501450 |
gactaatttatttacttattttcactcaaaa |
9501480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University