View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6141_high_4 (Length: 279)
Name: NF6141_high_4
Description: NF6141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6141_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 3 - 177
Target Start/End: Original strand, 24403586 - 24403763
Alignment:
| Q |
3 |
gacagagtgattgccttgatctgtgg-gagaagaatgaaaagagtactgttctgttta----tttgcagccattttacaagggacgatgatggtacatcg |
97 |
Q |
| |
|
||||||||| |||||||||||||||| | |||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24403586 |
gacagagtggttgccttgatctgtggagggaagaatgaa--gagtactgttctgtttaaggctttgcagccattttacaagggacgatgatggtacatcg |
24403683 |
T |
 |
| Q |
98 |
atagcatgtgcagtatcggatcgatttcacaagcatgaggaacagaatggcagcacaattgaaaatgaaacaaataacag |
177 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24403684 |
atagcatgtgtagtatcggatcgatttcacaagcatgaggaacagaatggcagcacaattgaaaatgaaacaaataacag |
24403763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 174 - 263
Target Start/End: Original strand, 24404000 - 24404088
Alignment:
| Q |
174 |
acagtacagaggcccgtattgcggtaaaccccaacaatagaatttcaaggactgctaaacatggaactgcagaaaacagcccctacaaca |
263 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24404000 |
acagtacagaggcccgtattgcggtaa-ccccaacaatagaatttcaaggactgctaaacatggaactgcagaaaacagcccctgcaaca |
24404088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 16 - 159
Target Start/End: Original strand, 12131501 - 12131648
Alignment:
| Q |
16 |
ccttgatctgtgg-gagaagaatgaaaagagtactgttctgttta----tttgcagccattttacaagggacgatgatggtacatcgatagcatgtgcag |
110 |
Q |
| |
|
||||||||||||| |||| |||||| ||||||||||||||||||| |||||| ||||||||| ||| ||||| || |||| ||||||| ||||| |
|
|
| T |
12131501 |
ccttgatctgtggagagatgaatgagaagagtactgttctgtttaaagctttgcaaccattttacgagg---gatgacggcacattaatagcatttgcag |
12131597 |
T |
 |
| Q |
111 |
tatc-ggatcgatttcacaagcatgaggaacaga-atggcagcacaattga |
159 |
Q |
| |
|
|||| ||||| ||||||||||| |||| || || |||||||||||||||| |
|
|
| T |
12131598 |
tatcaggatcattttcacaagcacgaggcaccgagatggcagcacaattga |
12131648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University