View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6142_high_5 (Length: 222)
Name: NF6142_high_5
Description: NF6142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6142_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 163
Target Start/End: Complemental strand, 41760560 - 41760398
Alignment:
| Q |
1 |
tatattttcaatattttcttcgacttctgtagaacatgctttaatttctatttcttcctctgcttcggcattttgttcattaggcttactagttatcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41760560 |
tatattttcaatattttcttcgacttctgtagaacatgctttaatttctatttcttcctctgcttcggcattttgttcattaggcttactagttatcttc |
41760461 |
T |
 |
| Q |
101 |
tcagcttctcgctccaatattggctcattggcctctacgtcaagaacatgatattgtgaacca |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41760460 |
tcagcttctcgctccaatattggctcattggcctctacgtcaagaacatgatattgtgaacca |
41760398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University