View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6143_low_3 (Length: 361)
Name: NF6143_low_3
Description: NF6143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6143_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 124 - 349
Target Start/End: Complemental strand, 48412449 - 48412224
Alignment:
| Q |
124 |
aattgacagggccgttaccaaatcgtatagcgtgaaatcagagaaaaaacccaaaaccgaaaccccaattgttatcagacgctcacttcgaaccagaggt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48412449 |
aattgacagggccgttaccaaatcgtatagcgtgaaatctgagaaaaaacccaaaaccgaaaccccaattgttatcagacgctcacttcgaaccagaggt |
48412350 |
T |
 |
| Q |
224 |
attccaccagattccaaaggctctgattctagcactctcactcgcaattcccctcaaaaaattaacgattttgttcaaaatttgggtcctattcccatga |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48412349 |
attccaccagattccaaaggctctgattctagcactctcactcgcaattcccctcaaaaaattaacgattttgttcaaaatttgggtcctattcccatga |
48412250 |
T |
 |
| Q |
324 |
aagatgcttataaaggcgatgatgat |
349 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
48412249 |
aagatgcttataaaggcgatgatgat |
48412224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University