View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6143_low_6 (Length: 296)
Name: NF6143_low_6
Description: NF6143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6143_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 7 - 282
Target Start/End: Complemental strand, 2371390 - 2371118
Alignment:
| Q |
7 |
tcgaataatatttagttttttgcgatttttgtgtttctgaatcggtttacgattttatggttcatcagtttggaattaaacatctctgccaacgggtaaa |
106 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2371390 |
tcgaaaaatatttagttttttgcgatttttgtgtttctgaaccggtttacggttttatggtgcatcagtttggaattaaacatctctgccaacgggtaaa |
2371291 |
T |
|
| Q |
107 |
aatgtcgtaatgtcttccaaaagctccttaatataccggtaatagtggcggttaacaaaaacaccttaacaaaatcatcataattcacatgttttttata |
206 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2371290 |
aatgtcataatgtcttccaaaagctccttaatataccggtaatagtggcggttaacaaaaacaccttaacaaaatcatcataattcacatgttttttata |
2371191 |
T |
|
| Q |
207 |
gtggttatccacaaccaaggcaacacattcctcttttggaactttatgaatattctttctatgaagtgagtaattg |
282 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2371190 |
gtggttatccacaaccaaggcaacacattgctcttttggaactttatgaa---tctttctatgaagtgagtaattg |
2371118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 207 - 243
Target Start/End: Original strand, 12128231 - 12128267
Alignment:
| Q |
207 |
gtggttatccacaaccaaggcaacacattcctctttt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12128231 |
gtggttatccacaaccaaggcaacacattactctttt |
12128267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University