View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6144_high_5 (Length: 291)
Name: NF6144_high_5
Description: NF6144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6144_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 18 - 210
Target Start/End: Complemental strand, 36606374 - 36606186
Alignment:
| Q |
18 |
ctatcctcagtttttt-attatctataattggattcaaattaaatgtcaacataaattcactttttaatgttaagaaaccaatttttaagtttgcttatc |
116 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36606374 |
ctatcctcagtttttttattatctataattggattcaaat-----gtcaacatgaattcactttttaatgttaagaaaccaatttttaagtttgcttatc |
36606280 |
T |
 |
| Q |
117 |
gagatcacgtcttttaattttcattgccacctaaacttactcaaatgatgaaaaattatgagagacctttattatatgtaagtgatactatata |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36606279 |
gagatcacgtcttttaattttcattgccacctaaacttactcaaatgatgaaaaattatgagagacctttattatatttaagtgatactatata |
36606186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 224 - 291
Target Start/End: Complemental strand, 36605846 - 36605779
Alignment:
| Q |
224 |
gtggtaacaaccacaaattcaaatcatttagacacacaattgtgtgatactatgtaggatgacttttc |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36605846 |
gtggtaacaaccacaaattcaaatcatttagacacacaattgtgtgatactatgtaggatgacttttc |
36605779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University