View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6144_low_6 (Length: 302)
Name: NF6144_low_6
Description: NF6144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6144_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 5e-90; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 6 - 185
Target Start/End: Complemental strand, 4521614 - 4521435
Alignment:
| Q |
6 |
agtgagaagaagaataagtgtttatcagatgtggatgaattccttcgttgcaaggaagctcctaagacaattatgcattgcttgagggattctgaaatga |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4521614 |
agtgagaagaagaataagtgtttatcagatgtggaagaattcattcgttgcaaggaagctcctaagacaattatgcattgcttgagggattctgaaatga |
4521515 |
T |
|
| Q |
106 |
ttaataatatcttggagaagtttataaatatggagacaaccattgagcaccttttttagtattggtcttcttcaatattg |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4521514 |
ttaataatatcttggagaagtttataaatatggagacaaccattgagcaccttttttagtattggttttcttcaatattg |
4521435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 187 - 286
Target Start/End: Complemental strand, 4521204 - 4521105
Alignment:
| Q |
187 |
ttgaggttttacttataatcttggtcgagccacatcggttttagctgagattttagggtcatgcatggcttcccctaatggcaagcaggtccgatcctaa |
286 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |||| ||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
4521204 |
ttgatgttttacttataatcttggtcgggccacatcggttttagctgaggttttagggtgatgcgtggcttcgcctaatggcgagcaggtccgatcctaa |
4521105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University