View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6144_low_9 (Length: 242)
Name: NF6144_low_9
Description: NF6144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6144_low_9 |
 |  |
|
| [»] scaffold0642 (1 HSPs) |
 |  |  |
|
| [»] scaffold0345 (1 HSPs) |
 |  |  |
|
| [»] scaffold0105 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0642 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0642
Description:
Target: scaffold0642; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 181 - 227
Target Start/End: Complemental strand, 8634 - 8588
Alignment:
| Q |
181 |
taatcaattcaatgttattgtctctccattattgaaacgtttgtttt |
227 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
8634 |
taatcaattcaatgttattgtctctctattattgaaatgtttgtttt |
8588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0345 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0345
Description:
Target: scaffold0345; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 181 - 227
Target Start/End: Complemental strand, 18547 - 18501
Alignment:
| Q |
181 |
taatcaattcaatgttattgtctctccattattgaaacgtttgtttt |
227 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
18547 |
taatcaattcaatgttattgtctctctattattgaaatgtttgtttt |
18501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 181 - 227
Target Start/End: Original strand, 20435 - 20481
Alignment:
| Q |
181 |
taatcaattcaatgttattgtctctccattattgaaacgtttgtttt |
227 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
20435 |
taatcaattcaatgttattgtctctctattattgaaatgtttgtttt |
20481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 181 - 227
Target Start/End: Original strand, 8193779 - 8193825
Alignment:
| Q |
181 |
taatcaattcaatgttattgtctctccattattgaaacgtttgtttt |
227 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
8193779 |
taatcaattcaatgttattgtctctctattattgaaatgtttgtttt |
8193825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 183 - 227
Target Start/End: Original strand, 19408368 - 19408412
Alignment:
| Q |
183 |
atcaattcaatgttattgtctctccattattgaaacgtttgtttt |
227 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
19408368 |
atcaattcaattttattgtctctcctttattgaaacgtttgtttt |
19408412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 93 - 161
Target Start/End: Original strand, 10459673 - 10459741
Alignment:
| Q |
93 |
ctcactattaatatttattgttaaatatgaaaaattctactgttaatcagtgcatcagatggcacacaa |
161 |
Q |
| |
|
|||||||||||||||||||||||||| | ||| ||| || |||||| | |||||||| | |||||||| |
|
|
| T |
10459673 |
ctcactattaatatttattgttaaatttaaaatattttattgttaacctatgcatcagtttgcacacaa |
10459741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 10928477 - 10928437
Alignment:
| Q |
181 |
taatcaattcaatgttattgtctctccattattgaaacgtt |
221 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10928477 |
taataaattcaatgttattgtctctccattattgaaacgtt |
10928437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 93 - 131
Target Start/End: Original strand, 20539533 - 20539571
Alignment:
| Q |
93 |
ctcactattaatatttattgttaaatatgaaaaattcta |
131 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
20539533 |
ctcactattaatatttattgttaaatttgaaatattcta |
20539571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University