View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6145_high_10 (Length: 240)
Name: NF6145_high_10
Description: NF6145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6145_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 86 - 223
Target Start/End: Original strand, 30767317 - 30767458
Alignment:
| Q |
86 |
aagaatgtgtccaatgtccattaatcttgatagagaatgatccatccat-taataagatgcatgaaagaaatttaaaaaggaacaaggagtgggag---a |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
30767317 |
aagaatgtgtccaatgtccattaatcttgatagagaatgatccatccatataataagatgcatgaaagaaatttaaaaaggaacaaggagtgggagaata |
30767416 |
T |
 |
| Q |
182 |
ataattttgctgagttttattcatttgttccataaagctaaa |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30767417 |
ataattttgctgagttttattcatttgttccataaagctaaa |
30767458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University