View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6145_high_7 (Length: 249)
Name: NF6145_high_7
Description: NF6145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6145_high_7 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 19 - 249
Target Start/End: Original strand, 39365059 - 39365289
Alignment:
| Q |
19 |
gtttgaccatgaaatgatcacatgatagaacaagcatgaggattgtcatcactaaaagtagcaccagtttgatggccaaagattgaagattgagaaggat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39365059 |
gtttgaccatgaaatgatcacatgatagaacaagcatgaggattgtcatcactaaaagtagcaccagtttgatggccaaagattgaagattgagaaggat |
39365158 |
T |
 |
| Q |
119 |
agtgataatggctaggatcactactatcataaccatgcttgtggtagttataagatgaggaaggttgtgaagcataatgagggatagggccattgcaaag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39365159 |
agtgataatggctaggatcactactatcataaccatgcttgtggtagttataagatgaggaaggttgtgaagcataatgagggatagggccattgcaaag |
39365258 |
T |
 |
| Q |
219 |
gtgttgttgataatattgactttgagattct |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39365259 |
gtgttgttgataatattgactttgagattct |
39365289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 58
Target Start/End: Complemental strand, 32313184 - 32313145
Alignment:
| Q |
19 |
gtttgaccatgaaatgatcacatgatagaacaagcatgag |
58 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
32313184 |
gtttgaccatgaaatgatcacataatagaccaagcatgag |
32313145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University