View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6145_low_11 (Length: 243)
Name: NF6145_low_11
Description: NF6145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6145_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 225
Target Start/End: Complemental strand, 6371185 - 6370979
Alignment:
| Q |
19 |
cgatgatgggtcgtgtgccgcggagagtagtggaaagggaggagttgaagaaagataagaaaaggaaagctactaggaagaggattcttaaagagaatga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6371185 |
cgatgatgggtcgtgtgccgcggagagtagtggaaagggaggagttgaagaaagataagaagaggaaagctactaggaagaggattcttaaagagaatga |
6371086 |
T |
|
| Q |
119 |
accgaaaccggatccgtattggttgagaacattctttagttttgctcccgaggaagctgctaaggtaccttgttatggtcattgtgggattttaagtcca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6371085 |
accgaaaccggatccgtattggttgagaacattctttagttttgctcctgaggaagctgctaaggtaccttgttatggtcattgtgggattttaagtcca |
6370986 |
T |
|
| Q |
219 |
ttgcttg |
225 |
Q |
| |
|
||||||| |
|
|
| T |
6370985 |
ttgcttg |
6370979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University