View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6145_low_8 (Length: 255)
Name: NF6145_low_8
Description: NF6145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6145_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 39365332 - 39365584
Alignment:
| Q |
1 |
tttcgaaccctttttagaaccttcttctgatcagcaaaaccattcaccgtcaccttttgcaacttcatgtctatttcaatgtcatccacacctttaaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39365332 |
tttcgaaccctttttagaaccttcttctgatcagcaaaaccattcaccgtcaccttttgcaacttcatgtctatttcaatgtcatccacacctttaaata |
39365431 |
T |
 |
| Q |
101 |
catacaaaaaatcatatgatcactattaccttatgcttggaaggaagatgaaaatgtacaaaat---------aaggtacctttcattttctgaagtgca |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39365432 |
aatacaaaaaatcatatgatcactattaccttatgcttggaaggaagatgaaaatgtacaaaataagcaaacgaaggtacctttcattttctgaagtgca |
39365531 |
T |
 |
| Q |
192 |
gttttcactttgttttcacatccagggcaatccatgtgcaccctcatctctgt |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39365532 |
gttttcactttgttttcacatccagggcaatccatgtgcaccctcatctctgt |
39365584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University