View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6146_high_2 (Length: 235)
Name: NF6146_high_2
Description: NF6146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6146_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 17 - 218
Target Start/End: Original strand, 3663057 - 3663252
Alignment:
| Q |
17 |
tctcattggctttttggattattcatgtaagattcattcacnnnnnnnattttcttaaataacttatgctatggttattgacaattattattaatatatc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3663057 |
tctcattggctttttggattattcatgtaagattcattcactttttt-attttcttaaataacttatgctatggttattgacaattattattaatatatc |
3663155 |
T |
 |
| Q |
117 |
tttagnnnnnnnnnctttcaaaattactagtgcaagtaataattaactttgaaattaaagtttgtatagccatggaaaatttgaaacatattaggattgg |
216 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3663156 |
tttagctttt-----tttcaaaattactagtgcaagtaataattaactttgaaattaaagtttgtatagccatggaaaatttgaaacatattaggattgg |
3663250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University