View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6146_low_3 (Length: 236)

Name: NF6146_low_3
Description: NF6146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6146_low_3
NF6146_low_3
[»] chr7 (1 HSPs)
chr7 (14-194)||(33506758-33506938)


Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 14 - 194
Target Start/End: Original strand, 33506758 - 33506938
Alignment:
14 agagacgaattaaagactaaaaaataaccgataaataaataggattgagtttgggacaagtaaaaggggttcaactctcattacaaggtgaagtagattt 113  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
33506758 agagacgagttaaagactaaaaaataaccgataaataaataggattgagtttgggacaagtagaaggggttcaactctcattacaaggtgaagtagattt 33506857  T
114 tgaaacccgactaaaagagataacaatatttaacgtttgacacctttaaatatgaatgacacaagtggagaaaatcaatga 194  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
33506858 tgaaacccgactaaaagagataacaatatttaatgtttgacacctttaaatatgaatgacacaagtggagaaaatcaatga 33506938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University