View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6146_low_3 (Length: 236)
Name: NF6146_low_3
Description: NF6146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6146_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 14 - 194
Target Start/End: Original strand, 33506758 - 33506938
Alignment:
| Q |
14 |
agagacgaattaaagactaaaaaataaccgataaataaataggattgagtttgggacaagtaaaaggggttcaactctcattacaaggtgaagtagattt |
113 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33506758 |
agagacgagttaaagactaaaaaataaccgataaataaataggattgagtttgggacaagtagaaggggttcaactctcattacaaggtgaagtagattt |
33506857 |
T |
 |
| Q |
114 |
tgaaacccgactaaaagagataacaatatttaacgtttgacacctttaaatatgaatgacacaagtggagaaaatcaatga |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33506858 |
tgaaacccgactaaaagagataacaatatttaatgtttgacacctttaaatatgaatgacacaagtggagaaaatcaatga |
33506938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University