View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6147_high_6 (Length: 263)
Name: NF6147_high_6
Description: NF6147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6147_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 255
Target Start/End: Original strand, 45545830 - 45546066
Alignment:
| Q |
18 |
cattgtttgtgttgctcttattgttgtcatcttattgtttatttgttgtggatttcagatttagttggagttgttaagaatgtgtcttcaaccatgagca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45545830 |
cattgtttgtgttgctcttattgttgtcatcttattgtttatttgttgtggatttcagatttagttggagttgttaagaatgtgtcttcaaccatgagca |
45545929 |
T |
 |
| Q |
118 |
tccgaagaaagagcaacaatgagactgttccaaagcgtgacattactattgccgatgaaacgttagtgttttcgattctcttttacagtgttaggcaagt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45545930 |
tccgtagaaagagcaacaatgagactgttccaaagcgtgacattactattgccgatgaaacgttagtgttttcgattctcttttacagtgttaggcaagt |
45546029 |
T |
 |
| Q |
218 |
gtttattttataatgnnnnnnngatcaatccctatgct |
255 |
Q |
| |
|
| ||||||||||||| |||||||||||||||| |
|
|
| T |
45546030 |
g-ttattttataatgtgtttttgatcaatccctatgct |
45546066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University