View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6147_low_2 (Length: 509)
Name: NF6147_low_2
Description: NF6147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6147_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 440; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 440; E-Value: 0
Query Start/End: Original strand, 46 - 497
Target Start/End: Complemental strand, 39254887 - 39254436
Alignment:
| Q |
46 |
ccttttccacaatctcttcctctttctcctcctcaaccatttcacttagccccaccgcggaagcgtagcggctactagccaccgaagcaaggtagcttct |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39254887 |
ccttttccacaatctcttcctctttctcctcctcaaccatttcacttagccccaccgcggaagcgtagcggctactagccaccgaagcaaggcagcttct |
39254788 |
T |
 |
| Q |
146 |
ggtcggagacggcgaattcagaaactccgatgcattatgaaacccatcctctccttgagtatcaatgatgctattaacattattttcaataaccactttt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39254787 |
ggtcggagacggcgaattcagaaactccgatgcattatgaaacccatcctctccttgagtatcaatgatgctattaacattattttcaataaccactttt |
39254688 |
T |
 |
| Q |
246 |
ttatggttattcttaccgttaagaatttgcggtggtgattggttgctttgaaggtgcataggtctcatggaccccaaaagcttcttccacatgcttttag |
345 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39254687 |
ttatggttattctcaccgttaagaatttgcggtggtgattggttgctttgaaggtgcataggtctcatggaccccaaaagcttcttccacatgcttttag |
39254588 |
T |
 |
| Q |
346 |
actcattatcaataggcataatcgattttgttttacgagaatgccctcgcaacatgaatacaacgatcttaaagaaattcttagatccttttgatgatcc |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39254587 |
actcattatcaataggcataatcgattttgttttacgagaatgccctcgcaacatgaatacaacgaccttaaagaaattcttagatccttttgatgatcc |
39254488 |
T |
 |
| Q |
446 |
cttcttgagaatgggttggggttgaggaatatgatctagggttgtttttgat |
497 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39254487 |
cttcttgagaatgggttggggttgaggaatatgatctagggttgtttttgat |
39254436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 53 - 103
Target Start/End: Complemental strand, 39255000 - 39254950
Alignment:
| Q |
53 |
cacaatctcttcctctttctcctcctcaaccatttcacttagccccaccgc |
103 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||||| |||| |
|
|
| T |
39255000 |
cacaatctcttcctttttctcctcctcaaccatttcatttagccccgccgc |
39254950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University