View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6149_high_22 (Length: 216)
Name: NF6149_high_22
Description: NF6149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6149_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 20 - 208
Target Start/End: Complemental strand, 43533267 - 43533079
Alignment:
| Q |
20 |
gtaatggtaatagtttcatggatgatttatgatttttcttggaattattgtgtttcttgggaattccaggtaaatgttcccaagaaaatgggacacctga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43533267 |
gtaatggtaatagtttcatggatgatttatgatttttcttggaattattgtgtttcttgggaattccaggtaaatgttcccaagaaaatgggacacctga |
43533168 |
T |
 |
| Q |
120 |
gaatctaagtggagtggcagggcttagaagaggatcatcaagaaaatagaatgattcaagggaagaagatgaaggtgaaagtgatgatg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43533167 |
gaatctaagtggagtggcagggcttagaagaggatcatcaagaaaatagaatgattcaagggaagaagatgaaggtgaaagtgatgatg |
43533079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University