View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6149_high_22 (Length: 216)

Name: NF6149_high_22
Description: NF6149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6149_high_22
NF6149_high_22
[»] chr1 (1 HSPs)
chr1 (20-208)||(43533079-43533267)


Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 20 - 208
Target Start/End: Complemental strand, 43533267 - 43533079
Alignment:
20 gtaatggtaatagtttcatggatgatttatgatttttcttggaattattgtgtttcttgggaattccaggtaaatgttcccaagaaaatgggacacctga 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43533267 gtaatggtaatagtttcatggatgatttatgatttttcttggaattattgtgtttcttgggaattccaggtaaatgttcccaagaaaatgggacacctga 43533168  T
120 gaatctaagtggagtggcagggcttagaagaggatcatcaagaaaatagaatgattcaagggaagaagatgaaggtgaaagtgatgatg 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43533167 gaatctaagtggagtggcagggcttagaagaggatcatcaagaaaatagaatgattcaagggaagaagatgaaggtgaaagtgatgatg 43533079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University