View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6149_low_12 (Length: 376)
Name: NF6149_low_12
Description: NF6149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6149_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 10 - 174
Target Start/End: Complemental strand, 27056281 - 27056116
Alignment:
| Q |
10 |
acatcatcaaataaaagtaaaatgcatctccagatcttctaatcaattgtaattaatgctttgcatgaggccaaatgttggtcgagcttggcaagattgg |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27056281 |
acatcaacaaataaaagtaaaatgcatctccagatcttctaatcaattgtaattaatgctttgcatgaggccaaatgttggtcaagcttggcaagattgg |
27056182 |
T |
|
| Q |
110 |
gagagacaacaaatttagagagtggaaattgacaaacgctacaaa-ggtatccgacatgttgaggc |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27056181 |
gagagacaacaaatttagagagtggaaattgacaaacgctacaaagggtatccgacatgttgaggc |
27056116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University