View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6150_low_3 (Length: 289)
Name: NF6150_low_3
Description: NF6150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6150_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 9 - 272
Target Start/End: Complemental strand, 2468028 - 2467765
Alignment:
| Q |
9 |
atcatcagaagacacattctgtgttgccaattggcattgagaatcggaattttcggcaacagagtcatcctcggaagcacgaacgaacccctatacgaaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2468028 |
atcatcagaagacacattctgtgttgccaattggcattgagaatcggaattttcggcaacagagtcatcctcggaagcacgaacgaatccctatacgaaa |
2467929 |
T |
|
| Q |
109 |
atgaaaataaatttgaggcattgaattgaatgaaatgaagttgaagataggttcaggaaattaccgttgtagcccgaaaaatgttggtgaattgaaagcg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2467928 |
atgaaaataaatttgaggcattgaattgaatgaaatgaagttgaagataggttcaggaaattaccgttgtagaccgaaaaatgttggtgaattgaaagcg |
2467829 |
T |
|
| Q |
209 |
tggtggtaatttgagattgcagcgaggagtaggaggggggaaaatggaagaggatataagtgag |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2467828 |
tggtggtaatttgagattgcagcgaggagtaggagggggaaaaatggaagaggatataagtgag |
2467765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University