View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6150_low_6 (Length: 217)

Name: NF6150_low_6
Description: NF6150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6150_low_6
NF6150_low_6
[»] chr1 (1 HSPs)
chr1 (21-202)||(29735367-29735548)


Alignment Details
Target: chr1 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 21 - 202
Target Start/End: Complemental strand, 29735548 - 29735367
Alignment:
21 ctagcgggagtgctgaaccggttcatagagaaccggagttggaccgtaaaaggaagggacgtgaaccggaagaatctgagtttcagagcgaggttagtag 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29735548 ctagcgggagtgctgaaccggttcatagagaaccggagttggaccgtaaaaggaagggacgtgaaccggaagaatctgagtttcagagcgaggttagtag 29735449  T
121 aatgcttttacgatgttattacgccgcttttttgttttctggtgtttgatgttcatggtctttggctattgtgcgctgatga 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29735448 aatgcttttacgatgttattacgccgcttttttgttttctggtgtttgatgttcatggtctttggctattgtgcgctgatga 29735367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University