View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6152_high_10 (Length: 252)
Name: NF6152_high_10
Description: NF6152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6152_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 10 - 236
Target Start/End: Original strand, 47308352 - 47308578
Alignment:
| Q |
10 |
attattctaaaaaggcttaaaattggtttttgttaatgtcctgcatgtaagcatcatgcatctcttcaatttttaagcagtttatttgttgtggtcctgt |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47308352 |
attattttaaaaaggcttaaaattggtttttgttaatgtcctgcacgtaagtatcatgcatctcttcaattattaagcagtttatttgttgtggtcctgt |
47308451 |
T |
 |
| Q |
110 |
tggcaactgctctgttgaaacaaacatgtaacacatggtttttattggaatatgtagtttgtcactttctcttggcatgtgtagagtatattatattata |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47308452 |
tggcaactgctctgttgaaacaaacatgtaacacatggtttttattggaatatgtagtttgtcactttctcttggcatgtgtagagtatattatattata |
47308551 |
T |
 |
| Q |
210 |
aacaaacactgtattaaactcaatatt |
236 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
47308552 |
aacaaacactgtattaaactcaatatt |
47308578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University