View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6152_high_11 (Length: 252)
Name: NF6152_high_11
Description: NF6152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6152_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 244
Target Start/End: Complemental strand, 49439047 - 49438822
Alignment:
| Q |
19 |
gttgccactagcgtcctatccaagagatggaagcatcaatggcgctcagttttcgatatcaacttaaccaacagcatatgcaaagaatatggagagtatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49439047 |
gttgccactagcgtcctatccaagagatggaagcatcaatggcgctcagttttcgatatcaacttaaccaacagcatatgcaaagaatatggagagtatt |
49438948 |
T |
 |
| Q |
119 |
acgaggaaataacattgaatactcaatatgcccttgatagctttaacgagtttgtgcactccattctgctcaagctagattccatcaagagttttcacct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49438947 |
gcgaggaaataacattgaatactcaatatgcccttgatagctttaacgagtttgtgtactccattctgctcaagctagattccatcaagagttttcacct |
49438848 |
T |
 |
| Q |
219 |
caaggttggatatggtagttcttctc |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
49438847 |
caaggttggatatggtagttcttctc |
49438822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 158 - 231
Target Start/End: Complemental strand, 49435065 - 49434992
Alignment:
| Q |
158 |
gctttaacgagtttgtgcactccattctgctcaagctagattccatcaagagttttcacctcaaggttggatat |
231 |
Q |
| |
|
|||| |||||||||||| |||| || || ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49435065 |
gcttcaacgagtttgtgtactctgttttgttcaagctagattccatcaagagtttctggctcaaggttggatat |
49434992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University