View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6152_high_12 (Length: 248)
Name: NF6152_high_12
Description: NF6152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6152_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 33751185 - 33751424
Alignment:
| Q |
1 |
caatgattgatgattgatgaatttgtttcattttttaattgtagcatctctcttttatgttttattgtggtggaagatggatgttatatctaaagatnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33751185 |
caatgattgatgattgatgaatttgtttcattttttaattgtagcatctctcttttatgttttattgtggtggaagatggatgttatatctaaagataaa |
33751284 |
T |
|
| Q |
101 |
nnnncttaatttagactgatttcatcaaattgatttttgtaattcttggattgatgtgaaccataggatttggtcatgatcctcttcgttttgttagagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33751285 |
aaaacttaatttagactgatttcatcaaattgatttttgtaattcttggattgatgtgaaccaaaggatttggtcatgatcctcttcgttttgttagagt |
33751384 |
T |
|
| Q |
201 |
catttgtacactctaatttctaggtgttttttatgatgat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33751385 |
catttgtacactctaatttctaggtgttttttatgatgat |
33751424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University