View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6152_high_15 (Length: 229)

Name: NF6152_high_15
Description: NF6152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6152_high_15
NF6152_high_15
[»] chr5 (1 HSPs)
chr5 (12-159)||(28060655-28060802)


Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 12 - 159
Target Start/End: Original strand, 28060655 - 28060802
Alignment:
12 agcagagagtatacgaacgaggaaagaaaatagtaaaataatttctaagtgtatgatgaatgatataaagaagggatcaagtggtatttgtgctagaatt 111  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||     
28060655 agcagaaagtatacgaacgaggaaagaaaatagtaaaataatttctaagtggatgatgaatgatataaagaagggatctagtggtatttgtgctagaatg 28060754  T
112 acactagggtttttcaaggggatacccctcataaacaccaagttagaa 159  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||    
28060755 acaatagggtttttcaaggggatacccctcataaacaccaagttagaa 28060802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University