View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6152_high_16 (Length: 211)

Name: NF6152_high_16
Description: NF6152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6152_high_16
NF6152_high_16
[»] chr7 (1 HSPs)
chr7 (18-202)||(27762440-27762624)


Alignment Details
Target: chr7 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 27762624 - 27762440
Alignment:
18 ggaactcggtaactcaactccaacggagttaaagtatttgattaactccgttacccataccgttggtgattcattgcttcgttgttgaaattgctttaaa 117  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
27762624 ggaactcggtaactcaactccaacggagttaaagtattcgattaactccgttacccataccgtgggtgattcattgcttcgttgttgaaattgctttaaa 27762525  T
118 cggtttgtaatggattccgttacggtttcgttccatgactccattctagaatgttctgtggtttgttccttttgaatttgatgat 202  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27762524 cggtttgtaatggattccgttacggtttcgttccatgactccattctagaatgttctgtggtttgttccttttgaatttgatgat 27762440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University