View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6152_low_11 (Length: 254)

Name: NF6152_low_11
Description: NF6152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6152_low_11
NF6152_low_11
[»] chr7 (1 HSPs)
chr7 (9-254)||(21481737-21481982)


Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 9 - 254
Target Start/End: Original strand, 21481737 - 21481982
Alignment:
9 gaagaatattaaaaagaatgtaaaatatgaaaatcggtttgaaccaaccacggtttaacccgaggattcacaattcaattagttgaatgggatgagttta 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
21481737 gaagaatattaaaaagaatgtaaaatatgaaaatcggtttgaaccaaccacggtttaacccgaggattcacaattcaatgagttgaacgggatgagttta 21481836  T
109 gtctggttttttaaaactttggtttgatctcgattcaattacgccgggaactaggaaatccaaatccatgaaaattaagtaaaagaaaacattataagag 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
21481837 gtctggttttttaaaactttggtttgatctcgattcaattacgccgggaactaggaaatccaaatccatgaacattaagtaaaagaaaacattataagag 21481936  T
209 aaggctcttacaaatttgccacacttcacatcagaatatatcacta 254  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
21481937 aaggctcttacaaatttgccacacttcacatcagaatatatcacta 21481982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University