View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6152_low_15 (Length: 243)
Name: NF6152_low_15
Description: NF6152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6152_low_15 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 9 - 243
Target Start/End: Complemental strand, 47308948 - 47308715
Alignment:
| Q |
9 |
aacacagaacaagaaaactgaaagaaactaataaaacaacacacataccctaaggtcccnnnnnnnnnnnnnnnnnnggataaccaataaacaactaaca |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
47308948 |
aacacacaacaagaaaactgaaagaaactaataaaacaacacacataccctaaggtcccttttttttttttttttt-ggataactaataaacaactaaca |
47308850 |
T |
|
| Q |
109 |
cacatagcttaacacactaattttaaaagggttactcctagcaggtatgaaatacatgtttatatattattacgccgatttttaccctcaaacttatcaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47308849 |
cacatagcttaacacactaattttaaaagggttactcctagcaggtatgaaatacatgtttatatattattacgccgatttttaccctcaaacttatcaa |
47308750 |
T |
|
| Q |
209 |
gcacctttttgccaaacatattgctacgcatcatt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
47308749 |
gcacctttttgccaaacatattgctacgcatcatt |
47308715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University