View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6152_low_17 (Length: 229)
Name: NF6152_low_17
Description: NF6152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6152_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 12 - 159
Target Start/End: Original strand, 28060655 - 28060802
Alignment:
| Q |
12 |
agcagagagtatacgaacgaggaaagaaaatagtaaaataatttctaagtgtatgatgaatgatataaagaagggatcaagtggtatttgtgctagaatt |
111 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28060655 |
agcagaaagtatacgaacgaggaaagaaaatagtaaaataatttctaagtggatgatgaatgatataaagaagggatctagtggtatttgtgctagaatg |
28060754 |
T |
|
| Q |
112 |
acactagggtttttcaaggggatacccctcataaacaccaagttagaa |
159 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28060755 |
acaatagggtttttcaaggggatacccctcataaacaccaagttagaa |
28060802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University