View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6153_low_5 (Length: 238)

Name: NF6153_low_5
Description: NF6153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6153_low_5
NF6153_low_5
[»] chr3 (1 HSPs)
chr3 (1-145)||(30836608-30836752)
[»] chr5 (1 HSPs)
chr5 (65-139)||(34536832-34536906)


Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 145
Target Start/End: Original strand, 30836608 - 30836752
Alignment:
1 tcgctattcctctctcctcagatcataaaccggatcgacccgatgaattactccgagtcgaagcagccggaggacgtgtgatctattgggatggtccaag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30836608 tcgctattcctctctcctcagatcataaaccggatcgacccgatgaattactccgagtcgaagcagccggaggacgtgtgatctattgggatggtccaag 30836707  T
101 agttcttggagtacttgccatgtctagagccataggtgactgaca 145  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
30836708 agttcttggagtacttgccatgtctagagccataggtgactgaca 30836752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 65 - 139
Target Start/End: Original strand, 34536832 - 34536906
Alignment:
65 agccggaggacgtgtgatctattgggatggtccaagagttcttggagtacttgccatgtctagagccataggtga 139  Q
    ||||||||||||||||||||||||||||||| ||||||| ||||||||  | |||||||| ||||| || |||||    
34536832 agccggaggacgtgtgatctattgggatggtgcaagagtgcttggagtgttggccatgtcaagagctattggtga 34536906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University