View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6153_low_5 (Length: 238)
Name: NF6153_low_5
Description: NF6153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6153_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 145
Target Start/End: Original strand, 30836608 - 30836752
Alignment:
| Q |
1 |
tcgctattcctctctcctcagatcataaaccggatcgacccgatgaattactccgagtcgaagcagccggaggacgtgtgatctattgggatggtccaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30836608 |
tcgctattcctctctcctcagatcataaaccggatcgacccgatgaattactccgagtcgaagcagccggaggacgtgtgatctattgggatggtccaag |
30836707 |
T |
|
| Q |
101 |
agttcttggagtacttgccatgtctagagccataggtgactgaca |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30836708 |
agttcttggagtacttgccatgtctagagccataggtgactgaca |
30836752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 65 - 139
Target Start/End: Original strand, 34536832 - 34536906
Alignment:
| Q |
65 |
agccggaggacgtgtgatctattgggatggtccaagagttcttggagtacttgccatgtctagagccataggtga |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||||| | |||||||| ||||| || ||||| |
|
|
| T |
34536832 |
agccggaggacgtgtgatctattgggatggtgcaagagtgcttggagtgttggccatgtcaagagctattggtga |
34536906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University