View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6154_high_20 (Length: 243)

Name: NF6154_high_20
Description: NF6154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6154_high_20
NF6154_high_20
[»] chr7 (1 HSPs)
chr7 (1-173)||(38931421-38931593)


Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 173
Target Start/End: Original strand, 38931421 - 38931593
Alignment:
1 gctcttgggttaaacacatcggcacgtgaaggatcagctatgttctcatgaagcttcaatgtgcaaacggtttcatcgaagaagttgtgttgttcttcat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||    
38931421 gctcttgggttaaacacatcggcacgtgaaggatcagctatgttctcatgaagcttcaatgtgcaaacagtttcatcgaagaagttgtgttgtccttcat 38931520  T
101 gttctctggttcttgttctctcaccatggcttctttctttttcaccatggtgacaatgctctttagtttttgt 173  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38931521 gttctctggttcttgttctctcaccatggcttctttctttttcaccatggtgacaatgctctttagtttttgt 38931593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University