View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6154_low_13 (Length: 288)
Name: NF6154_low_13
Description: NF6154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6154_low_13 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 288
Target Start/End: Original strand, 2862421 - 2862729
Alignment:
| Q |
1 |
acaagagtcttttattatgtttgtttgtgctgctgtttctttgactgggtctagtgctgctttagggttttttgttgggattgtactttactttttgttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2862421 |
acaagagtcttttattatgtttgtttgtgctgctgtttctttgactgggtctagtgctgctttagggttttttgttgggattgtactttactttttgttg |
2862520 |
T |
 |
| Q |
101 |
aaattgagggagcttgattgtggtgatggatttgggttcttgtc---------caagaccaaatcctctaaggatgaagaaactcccttaattgcctaga |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2862521 |
aaattgagggagcttgattgtggtgatggatttgggttcttgtccaattccaacaagactaaatcctctaaggatgaagaaactcccttaattgcctaga |
2862620 |
T |
 |
| Q |
192 |
cattttggtttgggttgtggttcgg------------atggattcatcaaaatcaaggattttctgcattcacgcagtcaataatttctagtaagtttca |
279 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2862621 |
cattttggtttgggttttggttcggatggagtgccgaatggattcatcaaaatcagggattttctgcattcacgcagtcaataatttctagtaagtttca |
2862720 |
T |
 |
| Q |
280 |
taaatattt |
288 |
Q |
| |
|
||||||||| |
|
|
| T |
2862721 |
taaatattt |
2862729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University