View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6154_low_15 (Length: 274)
Name: NF6154_low_15
Description: NF6154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6154_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 8e-67; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 35 - 167
Target Start/End: Original strand, 46034839 - 46034971
Alignment:
| Q |
35 |
ttgtataaccataaacttcttatcaatctactcctccatcaaaccacacttgtttagtttttcatgtcttcaaactctatatctttgttataatgtgatg |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46034839 |
ttgtataaccataaacttcttatcaatctactcctccatcaaaccacacttgtttagtttttcatgtcttcaaactctatatctttgttataatgtgatg |
46034938 |
T |
 |
| Q |
135 |
ttcctttggctttcccaactatagttgtatact |
167 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
46034939 |
ttcctttggctttcccagctatagttgtatact |
46034971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 197 - 265
Target Start/End: Original strand, 46034968 - 46035036
Alignment:
| Q |
197 |
tactacacaaagtgggttgattattatgagaaaaatagacccatcaaatttaattttatttctgatgat |
265 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
46034968 |
tactacacaaagtggattgattaatatgagaaaaatagacccatcaaattttattttatttcttatgat |
46035036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 19 - 52
Target Start/End: Original strand, 46034786 - 46034819
Alignment:
| Q |
19 |
aatacgccctagttgtttgtataaccataaactt |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
46034786 |
aatacgccctagttgtttgtataaccataaactt |
46034819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University