View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6154_low_21 (Length: 249)
Name: NF6154_low_21
Description: NF6154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6154_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 10 - 233
Target Start/End: Complemental strand, 49271520 - 49271297
Alignment:
| Q |
10 |
agaaattgtgtgcttagtagtgaagtgtgatgggtcataataaggattgcggatccataataagccacaaaattgcacacaaacagagtacttttctctg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49271520 |
agaaattgtgtgcttagtagtgaagtgtgatgggtcataataaggattgcggatccataataagccacaaaattgcacacaaacggagtacttttctctg |
49271421 |
T |
 |
| Q |
110 |
ttttaagatttgccactttctttttatcctcaaaggtgtaatgaagtttgaccttttgcttatacaatctgtctcaaatttctgtattttatatcttccc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49271420 |
ttttaagatttgccactttctttttatcctcaaaggtgtaatgaagtttgaccttatccttatacaatctgtctcaaatttctgtattttatatcttccc |
49271321 |
T |
 |
| Q |
210 |
ttacacattgtttctatttctatg |
233 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
49271320 |
ttacacattgtttctatttctatg |
49271297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University