View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6154_low_23 (Length: 243)
Name: NF6154_low_23
Description: NF6154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6154_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 173
Target Start/End: Original strand, 38931421 - 38931593
Alignment:
| Q |
1 |
gctcttgggttaaacacatcggcacgtgaaggatcagctatgttctcatgaagcttcaatgtgcaaacggtttcatcgaagaagttgtgttgttcttcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
38931421 |
gctcttgggttaaacacatcggcacgtgaaggatcagctatgttctcatgaagcttcaatgtgcaaacagtttcatcgaagaagttgtgttgtccttcat |
38931520 |
T |
|
| Q |
101 |
gttctctggttcttgttctctcaccatggcttctttctttttcaccatggtgacaatgctctttagtttttgt |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38931521 |
gttctctggttcttgttctctcaccatggcttctttctttttcaccatggtgacaatgctctttagtttttgt |
38931593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University