View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6155_high_12 (Length: 373)
Name: NF6155_high_12
Description: NF6155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6155_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 11 - 354
Target Start/End: Original strand, 32127811 - 32128154
Alignment:
| Q |
11 |
cacagacacggacgacgatgaaaaagattcagttcaagcaccaactccaacaccagctgaaccggttgaactaaggctgcgccgaagatcgaaaagacaa |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32127811 |
cacaaacacggacgacgatgaaaaagattcagttcaagcaccaactccaacaccagctgaaccggttgaactaaggctgcggcgaagatcgaaaagacaa |
32127910 |
T |
|
| Q |
111 |
gctagaaaacagagagagaatggaactctcacaaatagcatacagcaacccaaggcaaaggctgctcctaagaaatgggaggacatgagtttcactgaga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32127911 |
gctagaaaacagagagagaatggaactctcacaaatagcatacagcaacccaaggcaaaggctgctcctaagaaatgggaggacatgagtttcactgaga |
32128010 |
T |
|
| Q |
211 |
aggcacttgagctttatgtaggagagaaaggtgctctcttttggcttaacaaatttgcatatgcatcaatcttcataatgattgggctgtggatagcgtt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32128011 |
aggcacttgagctttatgtaggagagaaaggtgctctcttttggcttaacaaatttgcatatgcttcaatcttcataatgattgggctgtggatagcgtt |
32128110 |
T |
|
| Q |
311 |
taggtttgtgggtcctgcacttaatatttatcagttggatcaac |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32128111 |
taggtttgtgggtcctgcacttaatatttatcagctggatcaac |
32128154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University