View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6155_high_23 (Length: 226)
Name: NF6155_high_23
Description: NF6155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6155_high_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 2193970 - 2193756
Alignment:
| Q |
1 |
cggcggtggaggatgacgatgaaggtcgtaaggtggatattgatgtggtggatatggacgaggatcgtactgtatttgattcgcaacattttcactctca |
100 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2193970 |
cggcggtggaggatgacgataaacatcgtaaggtggatattgaggtggtggatatggacgaggattgtactgtatttgattcgcaacattttcactctca |
2193871 |
T |
|
| Q |
101 |
cctcgccggattgctgaattggcgtcgcggactgaccgtaagtgatcgtctccggtagctaactggtctcttccgccggagtatgaacggccggagtatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2193870 |
cctcgccggattgctgaattggcgtcgcggactgaccgtaagtgatcgtctccggtagctaactggtctcttccgccggagtatgaacggccggagtatc |
2193771 |
T |
|
| Q |
201 |
ctctccggtgacctc |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
2193770 |
ctctccggtgacctc |
2193756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University