View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6155_high_26 (Length: 206)
Name: NF6155_high_26
Description: NF6155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6155_high_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 115 - 200
Target Start/End: Original strand, 28309868 - 28309953
Alignment:
| Q |
115 |
taactagattgtgatttatgtaattcagttattaaaaaacaaatactaacctgaaataaatgcaccatttcattgcggctcaattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28309868 |
taactagattgtgatttatgtaattcagttattaaaaaacaaatactaacctgaaataaatgcaccatttcattgcggctcaattt |
28309953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 10 - 92
Target Start/End: Original strand, 28309762 - 28309844
Alignment:
| Q |
10 |
aaatgtatgtagttaaattcgaccactagttgccaacacaaatttctcctcccacaaataaattaactatcatacgccaattt |
92 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |||||| || |||||||||||||||||||||||| |
|
|
| T |
28309762 |
aaatgtatgtagttgaattcgaccactagttgccaacacaaatttctcttcccactaacaaattaactatcatacgccaattt |
28309844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University