View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6155_low_17 (Length: 300)
Name: NF6155_low_17
Description: NF6155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6155_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 10 - 285
Target Start/End: Original strand, 9379751 - 9380026
Alignment:
| Q |
10 |
acatcatcagaagattggagtgcttttgaatcaaatgatttattaggccaatcaagttgtgattatcaatggtgggacttttggtcttgaatgaaacaga |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9379751 |
acatcaccagaagattggagtgcttttgaatcaaatgatttattaggccaatcaagttgtgattatcaatggtgggacttttggtcttgaatgaaacaga |
9379850 |
T |
 |
| Q |
110 |
ggaggaaaatatgtgtggaggaaatatatgcaaaatttatgatgttagaatcatcattgttttgttgaagaagttgtcagaggaaaatcaagggacattt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9379851 |
ggaggaaaatatgtgtggaggaaatatatgcaaaatttatgatgttagaatcatcattgttttgttgaagaagttgtcagaggaaaatcaagggacattt |
9379950 |
T |
 |
| Q |
210 |
tgttttttgtacaacataatcattagtttgtaggaaatgattttcatctctgcggttcgatcttgtttggataaat |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9379951 |
tgttttttgtacaacataatcattagtttgtaggaaatgattttcatctctgcggttcgatcttgtttggataaat |
9380026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University