View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6155_low_21 (Length: 252)

Name: NF6155_low_21
Description: NF6155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6155_low_21
NF6155_low_21
[»] chr4 (1 HSPs)
chr4 (10-227)||(47737296-47737513)


Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 10 - 227
Target Start/End: Complemental strand, 47737513 - 47737296
Alignment:
10 gacatcatcatagaaaacaaaaacaattaccaaaacggagatgaactattgtgagacaaattgtgttgtcaagaggaacaaaggtaaagaaactgatgaa 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47737513 gacatcatcatagaaaacaaaaacaattaccaaaacggagatgaactattgtgagacaaattgtgttgtcaagaggaacaaaggtaaagaaactgatgaa 47737414  T
110 accttgtcttttacacagtccaaggataatataaagatgtcgcatgatcggaacaaaggaaaacaacaacgttacgctcttgtctcgtttatggagctac 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||    
47737413 accttgtcttttacacagtccaaggataatataaagatgtcgcatgatcggaacaaaggaaaacaacaacgttactctcttgtctcgtttatggaactac 47737314  T
210 cgaattatatgaaggata 227  Q
    ||||||||||||||||||    
47737313 cgaattatatgaaggata 47737296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University