View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6155_low_21 (Length: 252)
Name: NF6155_low_21
Description: NF6155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6155_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 10 - 227
Target Start/End: Complemental strand, 47737513 - 47737296
Alignment:
| Q |
10 |
gacatcatcatagaaaacaaaaacaattaccaaaacggagatgaactattgtgagacaaattgtgttgtcaagaggaacaaaggtaaagaaactgatgaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47737513 |
gacatcatcatagaaaacaaaaacaattaccaaaacggagatgaactattgtgagacaaattgtgttgtcaagaggaacaaaggtaaagaaactgatgaa |
47737414 |
T |
 |
| Q |
110 |
accttgtcttttacacagtccaaggataatataaagatgtcgcatgatcggaacaaaggaaaacaacaacgttacgctcttgtctcgtttatggagctac |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
47737413 |
accttgtcttttacacagtccaaggataatataaagatgtcgcatgatcggaacaaaggaaaacaacaacgttactctcttgtctcgtttatggaactac |
47737314 |
T |
 |
| Q |
210 |
cgaattatatgaaggata |
227 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
47737313 |
cgaattatatgaaggata |
47737296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University