View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6156_low_4 (Length: 212)
Name: NF6156_low_4
Description: NF6156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6156_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 18 - 180
Target Start/End: Original strand, 53793713 - 53793877
Alignment:
| Q |
18 |
gtaagcacacttccggacagcacaaaaactgttatttcctacgtgtgtttgaaatggtttctgggattg-nnnnnnnttcgtccctttgaca-nnnnnnn |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
53793713 |
gtaagcacacttccggacagcacaaaaactgttatttcctacgtgtgtttgaaatggtttctgggattgaaaaaaaattcgtccctttgacatttttttt |
53793812 |
T |
 |
| Q |
116 |
ctttaacaatatactaatctgatgttttatttaagaagaatcaagcttcttgccacttggaccca |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53793813 |
ctttaacaatatactaatctgatgttttatttaagaagaatcaagcttcttgccacttggaccca |
53793877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University