View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6157_high_15 (Length: 371)
Name: NF6157_high_15
Description: NF6157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6157_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 16 - 353
Target Start/End: Original strand, 46260038 - 46260375
Alignment:
| Q |
16 |
atgaactagggtggaatccagtggggtaaggtataccgatatcgaaatagtcccatggattacgctctatcagaaggcgagtgatgtttcttaaccctgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46260038 |
atgaactagggtggaatccagtggggtaaggtataccgatatcgaaatagtcccatggattacgctctatcagaaggcgagtgatgtttcttaaccctgg |
46260137 |
T |
|
| Q |
116 |
cttgtagatgcaactagaaccccaatcttcatctttggaacgacgaaaatcccatgtgatgcgccccattgtaatgaagtgatcccaaccgtttgattct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46260138 |
cttgtagatgcaactagaaccccaatcttcatctttggaacgacgaaaatcccatgtgatgcgccccattgtaatgaagtgatcccaaccgtttgattct |
46260237 |
T |
|
| Q |
216 |
ttgtaatacggttgttcattcagccatatcaacatcttttcgcagtgactatcgcgatccttcgcggtggaggtattcatccataagtattttcccactg |
315 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46260238 |
ttgtaatacggttgttcattaagccatatcaacatcttttcgcagtgactatcgcgatccttcgcggtggaggtgttcatccataagtattttcccactg |
46260337 |
T |
|
| Q |
316 |
cgagtccaacgtagaatggaacatagaaccccgcagcg |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46260338 |
cgagtccaacgtagaatggaacatagaaccccgcagcg |
46260375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University