View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6157_high_37 (Length: 248)
Name: NF6157_high_37
Description: NF6157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6157_high_37 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 26 - 248
Target Start/End: Original strand, 31667101 - 31667323
Alignment:
| Q |
26 |
gttgcttcacgggagagatcatgatcatgtaaacgcactgcatagatggaaagagattttaggttggcaattgaatgaatttcattctgaaaggtgcttt |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31667101 |
gttgcttcacgggagagatcatgatcatgtaaacatactgcatagatggaaagagattttaggttggcaattgaatgaatttcattctgaaaggtgcttt |
31667200 |
T |
 |
| Q |
126 |
tgcaattgcatctatactttttgtttttgttaacagataattggtgaaaggtgtgtttgtatatctagtattgttgatcaaatgttgagtatagtttatt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31667201 |
tgcaattgcatctatactttttgtttttattaacagataattggtgaaaggtgtgtttgtatatctagtattgttgatcaaatgttgagtatagtttatt |
31667300 |
T |
 |
| Q |
226 |
atgaagcactgacacaaagacga |
248 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
31667301 |
atgaagcactgacacaaagacga |
31667323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University