View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6157_high_38 (Length: 244)
Name: NF6157_high_38
Description: NF6157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6157_high_38 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 244
Target Start/End: Complemental strand, 21658391 - 21658166
Alignment:
| Q |
19 |
ataatataaatattttaattaatcaaattattatatcttaggtatatccccagtaaattatcaaagggaggtgatcactgagtatgatgagttatctcat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21658391 |
ataatataaatattttaattaatcaaattattatatcttaggtatagccccagtaaattatcaaagggaggtgatcactgagtatgatgagttatctcat |
21658292 |
T |
|
| Q |
119 |
acaattgggctccaagtggttgaaggaggctatctgaatcaagggttgtcatactacaagacaacttttcaattctcagcaatatcagagaataaaactt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
21658291 |
acaattgggctccaagtggttgaaggaggctatctgaatcaaggcttgtcatactacaagacaactttccaattctcagcaatatcagagaataaaactt |
21658192 |
T |
|
| Q |
219 |
tggtgaatgtgaagatctcttatgat |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
21658191 |
tggtgaatgtgaagatctcttatgat |
21658166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University